week 4

Considering the Jukes-Cantor, Kimura Evolution Models and the three sequences below from a similar DNA location of different species, evaluate the statements:

Sequence 1: AATGATGACGTTAGGAAAACTAGACGGTACGTAGT
Sequence 2: AATAATGACGTTAGGAAAATTAGACAGTAGGCAGT
Sequence 3: AAAAATGACGTAAGGAAAATTAGACAGCAGGTAGT

I - Considering the Jukes-Cantor Model, the distance between sequences 1 and 2 and between 2 and 3 are the same.
II - Considering the Kimura Evolution Model, the distance between 1 and 2 is different from the distance between 2 and 3 despite having the same rate of differences.
III - The distance between 1 and 3 is greater than the distance between 1 and 2 and the distance between 2 and 3 no matter which of the two models is considered.

Choose the correct alternative

a) Only statement I is correct.
b) Only statements I and II are correct.
c) Only statement III is correct.
d) Only statements II and III are correct.
e) None of the above.

Original idea by Mario Akita