Considering the PQR tree below, which of the alternatives contains sets that do NOT belong to the tree's complete collection?
a) { M N } and { M O }
b) { C D } and{ K L }
c) { A B }, { J K } and { L M }
d) { E F G }, { G H } and { H I }
e) None of the above.
Original idea by: Daniel M. Ivasse
Translation Help by: Mario Akita
sexta-feira, 12 de junho de 2015
quarta-feira, 3 de junho de 2015
week 14
Guiven the PQ-tree T below, analyze the statements:
I) T is consistent.
II) FRONTIER(T) is the permutation ABCDEFGHIJKLMNOP.
III) T is PERTINENT(T,S) if S={A,B,G,K,M}
IV) T is PRUNED (T,S) if and only if S contains all the leaves of the tree.
Which statements are correct?
a) IV, only
b) I and III, only
c) I, III and IV, only
d) I, II, III and IV
e) None of the above
Original Idea by Mario Akita
I) T is consistent.
II) FRONTIER(T) is the permutation ABCDEFGHIJKLMNOP.
III) T is PERTINENT(T,S) if S={A,B,G,K,M}
IV) T is PRUNED (T,S) if and only if S contains all the leaves of the tree.
Which statements are correct?
a) IV, only
b) I and III, only
c) I, III and IV, only
d) I, II, III and IV
e) None of the above
Original Idea by Mario Akita
quinta-feira, 28 de maio de 2015
week 13
Considering the statements below about Benzer, 1959 study:
I - A qualitative approach to studying mutations was used rather than a quantitative one.
II - Mutations at a region called "rII" of a virus were used to demonstrate the theory.
III - The author was interested in whether or not two individuals had mutations that overlap.
IV - According to the definition of overlapping mutations, it is possible to recover the original genome if and only if the mutants have overlapping mutations.
V- The recombination matrix is devised by assigning 1 for the matrix element a[i,j] if they have an overlapping mutation and 0 otherwise,
How many statements are true?
a) 1
b) 2
c) 3
d) 4
e) None of the above.
Original idea by Mario Akita
I - A qualitative approach to studying mutations was used rather than a quantitative one.
II - Mutations at a region called "rII" of a virus were used to demonstrate the theory.
III - The author was interested in whether or not two individuals had mutations that overlap.
IV - According to the definition of overlapping mutations, it is possible to recover the original genome if and only if the mutants have overlapping mutations.
V- The recombination matrix is devised by assigning 1 for the matrix element a[i,j] if they have an overlapping mutation and 0 otherwise,
How many statements are true?
a) 1
b) 2
c) 3
d) 4
e) None of the above.
Original idea by Mario Akita
sexta-feira, 22 de maio de 2015
week 12
Consider a genome below that will be sorted using the block interchange method.
1 8 3 6 4 3 2 9 7 5
It is correct that:
I - The sequence can be sorted in 4 steps.
II- No negative numbers will appear during the process of sorting though block interchanges.
III- Sorting through block interchange takes less steps than sorting this same sequence though reversals.
Which statements are correct?
a) I and II, only.
b) I and III, only.
c) II and III, only.
d) I, II and III.
e) None of the above.
Original idea by Mario Akita
1 8 3 6 4 3 2 9 7 5
It is correct that:
I - The sequence can be sorted in 4 steps.
II- No negative numbers will appear during the process of sorting though block interchanges.
III- Sorting through block interchange takes less steps than sorting this same sequence though reversals.
Which statements are correct?
a) I and II, only.
b) I and III, only.
c) II and III, only.
d) I, II and III.
e) None of the above.
Original idea by Mario Akita
quinta-feira, 14 de maio de 2015
week11
Considering the permutation
(6 7 4 5 1 2 3 8)
it is correct to affirm that:
a) it is sortable by just applying Algorith 1 from Bergeron, 2005
b) does not contain hurdles
c) has 2 oriented pairs
d) is sortable by applying 3 reversions
e) None of the above
Original idea by Mario Akita
(6 7 4 5 1 2 3 8)
it is correct to affirm that:
a) it is sortable by just applying Algorith 1 from Bergeron, 2005
b) does not contain hurdles
c) has 2 oriented pairs
d) is sortable by applying 3 reversions
e) None of the above
Original idea by Mario Akita
sexta-feira, 8 de maio de 2015
week 10
A genome underwent a operation that changed it as showed by the representations below:
Before:
πadj = (-A B) (-B D) (-D C) (-C -F)
After:
πadj = (-D C) (-C -F) (F A) (-A B) (-B D)
What operation happened?
a) Linear fission
b) Circularization
c) Reversal
d) Transposition
e) None of the above
Original idea by: Mario Akita
Before:
πadj = (-A B) (-B D) (-D C) (-C -F)
After:
πadj = (-D C) (-C -F) (F A) (-A B) (-B D)
What operation happened?
a) Linear fission
b) Circularization
c) Reversal
d) Transposition
e) None of the above
Original idea by: Mario Akita
sexta-feira, 1 de maio de 2015
week 9
Considering the graphs below that represent permutations and the results of operation with permutations:
Choose the alternative that correctly relate the graph to its operation:
a) I - α(β); II - β; III - β(α); IV - α
b) I - β; II - β(α); III - α; IV - α(β)
c) I - α(β); II - α; III - β(α); IV - β
d) I - α; II - α(β); III - β; IV - β(α)
e) None of the above.
Choose the alternative that correctly relate the graph to its operation:
a) I - α(β); II - β; III - β(α); IV - α
b) I - β; II - β(α); III - α; IV - α(β)
c) I - α(β); II - α; III - β(α); IV - β
d) I - α; II - α(β); III - β; IV - β(α)
e) None of the above.
sexta-feira, 24 de abril de 2015
week 8
Choose the incorrect alternative considering the Double-cut-and-Join operation
a) This operation occurs on a set of four vertices initially divided in two pairs.
b) The fist part of DCJ operation is breaking the existing connections between the vertices.
c) The second part of DCJ operation is joining the vertices in a way that each vertex gets connected to another vertex which is different from the one it was previously connected to.
d) There are three different outcome configuration possible after the second part of the DCJ operation since for each considered vertex, there are 3 possible vertices that can be connected to it (and 1 vertex that is discarded - the one which was originally connected to the vertex considered)
e) None of the above
Original idea by Mario Akita
a) This operation occurs on a set of four vertices initially divided in two pairs.
b) The fist part of DCJ operation is breaking the existing connections between the vertices.
c) The second part of DCJ operation is joining the vertices in a way that each vertex gets connected to another vertex which is different from the one it was previously connected to.
d) There are three different outcome configuration possible after the second part of the DCJ operation since for each considered vertex, there are 3 possible vertices that can be connected to it (and 1 vertex that is discarded - the one which was originally connected to the vertex considered)
e) None of the above
Original idea by Mario Akita
sexta-feira, 17 de abril de 2015
week 7
Given the definition of Weighted Multichromosomal distance (WMGMP) below, evaluate the statements considering SCJ distance.
II. The median between two or more identical genes is a empty
III. Considering two or more genomes with no common adjacencies, the median between them is a set containing all the adjacencies from all the genomes.
IV. There is no known polynomial algorithm to solve WMGMP
Chose the correct alternative:
a) Only I and IV are correct.
b) Only I and II are correct.
c) Only II, III are correct.
d) Only IV is wrong.
e) None of the above.
Original idea by: Mario Akita
WMGMP consists in, given a set of genomes with the same set genes, finding a genome that minimizes the sum of the distances between the median and each genome of the set multiplied by its weight.I. It is possible to find more than one different genomes that are answers to this problem.
II. The median between two or more identical genes is a empty
III. Considering two or more genomes with no common adjacencies, the median between them is a set containing all the adjacencies from all the genomes.
IV. There is no known polynomial algorithm to solve WMGMP
Chose the correct alternative:
a) Only I and IV are correct.
b) Only I and II are correct.
c) Only II, III are correct.
d) Only IV is wrong.
e) None of the above.
Original idea by: Mario Akita
sexta-feira, 10 de abril de 2015
week 6
sexta-feira, 3 de abril de 2015
week 5
Consider the phylogenetic trees below.
a) I, only
b) III, only
c) I and II, only
d) I, II and III
e) None of the above
Original Idea by: Mario Akita
sexta-feira, 27 de março de 2015
week 4
Considering the Jukes-Cantor, Kimura Evolution Models and the three sequences below from a similar DNA location of different species, evaluate the statements:
Sequence 1: AATGATGACGTTAGGAAAACTAGACGGTACGTAGT
Sequence 2: AATAATGACGTTAGGAAAATTAGACAGTAGGCAGT
Sequence 3: AAAAATGACGTAAGGAAAATTAGACAGCAGGTAGT
I - Considering the Jukes-Cantor Model, the distance between sequences 1 and 2 and between 2 and 3 are the same.
II - Considering the Kimura Evolution Model, the distance between 1 and 2 is different from the distance between 2 and 3 despite having the same rate of differences.
III - The distance between 1 and 3 is greater than the distance between 1 and 2 and the distance between 2 and 3 no matter which of the two models is considered.
Choose the correct alternative
a) Only statement I is correct.
b) Only statements I and II are correct.
c) Only statement III is correct.
d) Only statements II and III are correct.
e) None of the above.
Original idea by Mario Akita
Sequence 1: AATGATGACGTTAGGAAAACTAGACGGTACGTAGT
Sequence 2: AATAATGACGTTAGGAAAATTAGACAGTAGGCAGT
Sequence 3: AAAAATGACGTAAGGAAAATTAGACAGCAGGTAGT
I - Considering the Jukes-Cantor Model, the distance between sequences 1 and 2 and between 2 and 3 are the same.
II - Considering the Kimura Evolution Model, the distance between 1 and 2 is different from the distance between 2 and 3 despite having the same rate of differences.
III - The distance between 1 and 3 is greater than the distance between 1 and 2 and the distance between 2 and 3 no matter which of the two models is considered.
Choose the correct alternative
a) Only statement I is correct.
b) Only statements I and II are correct.
c) Only statement III is correct.
d) Only statements II and III are correct.
e) None of the above.
Original idea by Mario Akita
sexta-feira, 20 de março de 2015
Week 3
During the sequencing of a organism, a researcher found 3 different base sequences for a certain region of interest. By aligning the sequences, which of the alternatives below is a probable original sequence of this organism?
Sequence 1: AAAGCCACGGGGAAGCTGACGTCCA
Sequence 2: AAAGCCAGCGCAAGCTGACGCCCA
Sequence 3: AATAGCCACGGGGCAAGCTGACGTCA
a) AA-AGCCA-GCG-CAAGCTGACGCCCA
b) AATAGCCACGGGGCAAGCTGACGTCCA
c) AAAGCCACGGGGCAAGCTGACCTCCA
d) AAAGCCAGGGAAGCTGACCTCAAA
e) None of the above
sexta-feira, 6 de março de 2015
1st week question
1) Which of the alternatives contains a true assertion about the structure of proteins?
a) The primary structure of a protein has todo with the order in which the amino acids are organized and therefore, is not important to determine the function of this protein.
b) Alpha-helix and beta-pleated sheets are shapes in which proteins fold and, therefore, are related to the primary structure of a protein.
c) The tertiary structure is a general overview of the protein as a whole or a part of a more complex protein.
d) The quaternary structure has to do with the way several primary structures interact to form a complex protein.
e) None of the above.
a) The primary structure of a protein has todo with the order in which the amino acids are organized and therefore, is not important to determine the function of this protein.
b) Alpha-helix and beta-pleated sheets are shapes in which proteins fold and, therefore, are related to the primary structure of a protein.
c) The tertiary structure is a general overview of the protein as a whole or a part of a more complex protein.
d) The quaternary structure has to do with the way several primary structures interact to form a complex protein.
e) None of the above.
Assinar:
Postagens (Atom)







